About   Help   FAQ
D7Mit301 Primer Detail
Primers
  • Name
    D7Mit301
  • Primer 1 Sequence
    CTGTGAAGTATGCTTTCTCTTACACA
  • Primer 2 Sequence
    TGCTTTGCAGATGGCTCTAC
  • ID
    MGI:701057
  • Product Size
    119
  • Other IDs
    D7Mit301 (BROAD)
  • Note
    MIT assay: MTH695
    Additional information: MIT STS Marker Data Files
Genes
D7Mit301 DNA segment, Chr 7, Massachusetts Institute of Technology 301
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit301 a 101bp SPRET/EiJ
b 115bp B6.Cg-Lepob/+, C57BL/6J
c 125bp CAST/EiJ, NOD/MrkTac
d 127bp DBA/2J
e 131bp A/J, AKR/J, BALB/cJ, NON/ShiLt
f 133bp LP/J
g 135bp C3H/HeJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D7Mit301 a 135bp A.CA/W, C3H/W, CBA/W
b 131bp AKR/W, BALB/cW, BN/aW
c 127bp DBA/2W
d 115bp 129/SvW, C57BL/6W, C57BL/10W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory