About   Help   FAQ
D4Mit31 Primer Detail
Primers
  • Name
    D4Mit31
  • Primer 1 Sequence
    ACGAGTTGTCCTCTGATCAACA
  • Primer 2 Sequence
    AGCCAGAGCAAACACCAACT
  • ID
    MGI:701009
  • Product Size
    121
  • Other IDs
    D4Mit31 (BROAD)
  • Note
    MIT assay: B133
    Additional information: MIT STS Marker Data Files
Genes
D4Mit31 DNA segment, Chr 4, Massachusetts Institute of Technology 31
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D4Mit31 c 112bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit31 a 104bp CAST/EiJ
b 112bp BALB/cJ, C3H/HeJ, NOD/MrkTac
c 120bp AKR/J, DBA/2J
d 122bp B6.Cg-Lepob/+, C57BL/6J
e 130bp A/J, LP/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory