About   Help   FAQ
D10Mit86 Primer Detail
Primers
  • Name
    D10Mit86
  • Primer 1 Sequence
    TTTGCCTGTAACAAGCCAGA
  • Primer 2 Sequence
    TTGAGGCTATCAGTTTAAAATCCC
  • ID
    MGI:701008
  • Product Size
    148
  • Other IDs
    D10Mit86 (BROAD)
  • Note
    MIT assay: D962
    Additional information: MIT STS Marker Data Files
Genes
D10Mit86 DNA segment, Chr 10, Massachusetts Institute of Technology 86
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit86 a 144bp SPRET/EiJ
b 150bp A/J, AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
c 152bp CAST/EiJ
d 156bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D10Mit86 c 147bp A/JOlaHsd, AKR/OlaHsd, BALB/cJ, C3H/HeJ, JF1, SJL/J
d 153bp C57BL/6JOlaHsd, C57BL/10, DBA/2J
g 137bp 129P3/J
p 145bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory