D12Mit167 Primer Detail MGI Mouse MGI:700993

D12Mit167 Primer Detail

Name

D12Mit167
Primer 1 Sequence

AGAAGAAATACAGTTGTTGGAGCC
Primer 2 Sequence

CTGGAGCAGACTGCAGTGAG
ID

MGI:700993
Product Size

150
Other IDs

D12Mit167 (BROAD)
Note

MIT assay: MT1399
Additional information: MIT STS Marker Data Files

DNA segment, Chr 12, Massachusetts Institute of Technology 167

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit167	a	144bp	A/J, BALB/cJ, C3H/HeJ, NON/ShiLt
	b	152bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac
	c	154bp	CAST/EiJ
	d	156bp	DBA/2J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D12Mit167	a	146bp	129P3/J, AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, JF1
	c	140bp	A/JOlaHsd, BALB/cJ, C3H/HeJ, PWB, SJL/J
	d	150bp	DBA/2J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23