D11Mit242 Primer Detail MGI Mouse MGI:700971

D11Mit242 Primer Detail

Name

D11Mit242
Primer 1 Sequence

GAAGCCAGCAAGAAAAATGC
Primer 2 Sequence

CTGTCTGGTAGTGCAGCCAA
ID

MGI:700971
Product Size

116
Other IDs

D11Mit242 (BROAD)
Note

MIT assay: MTAR4119
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 242

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit242	a	104bp	BALB/cJ
	b	122bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
	c	124bp	CAST/EiJ, NOD/MrkTac
	d	128bp	AKR/J
	e	136bp	C3H/HeJ
	f	138bp	A/J
	g	142bp	SPRET/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D11Mit242	a	116bp	AKR/OlaHsd
	c	114bp	129P3/J, BALB/cJ, C57BL/6JOlaHsd, C57BL/10
	d	120bp	DBA/2J
	h	126bp	C3H/HeJ
	j	108bp	JF1
	p	96bp	PWB, SJL/J
	w	128bp	A/JOlaHsd

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit242	c	142bp	CBA/CaOlaHsd
	D11Mit242	s	146bp	SWR/OlaHsd

J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit242	c	upper	CBA/Kw
	D11Mit242	k	lower	KE

J:156851 Golas A, MGI Direct Data Submission. 2010;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit242	b	lower	C57BL/6J
	D11Mit242	s	upper	129/Sv

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24