About   Help   FAQ
D11Mit242 Primer Detail
Primers
  • Name
    D11Mit242
  • Primer 1 Sequence
    GAAGCCAGCAAGAAAAATGC
  • Primer 2 Sequence
    CTGTCTGGTAGTGCAGCCAA
  • ID
    MGI:700971
  • Product Size
    116
  • Other IDs
    D11Mit242 (BROAD)
  • Note
    MIT assay: MTAR4119
    Additional information: MIT STS Marker Data Files
Genes
D11Mit242 DNA segment, Chr 11, Massachusetts Institute of Technology 242
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit242 a 104bp BALB/cJ
b 122bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
c 124bp CAST/EiJ, NOD/MrkTac
d 128bp AKR/J
e 136bp C3H/HeJ
f 138bp A/J
g 142bp SPRET/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D11Mit242 a 116bp AKR/OlaHsd
c 114bp 129P3/J, BALB/cJ, C57BL/6JOlaHsd, C57BL/10
d 120bp DBA/2J
h 126bp C3H/HeJ
j 108bp JF1
p 96bp PWB, SJL/J
w 128bp A/JOlaHsd
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit242 c 142bp CBA/CaOlaHsd
s 146bp SWR/OlaHsd
J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;
Endonuclease Gene Allele Fragments Strains
D11Mit242 c upper CBA/Kw
k lower KE
J:156851 Golas A, MGI Direct Data Submission. 2010;
Endonuclease Gene Allele Fragments Strains
D11Mit242 b lower C57BL/6J
s upper 129/Sv
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory