About   Help   FAQ
D11Mit243 Primer Detail
Primers
  • Name
    D11Mit243
  • Primer 1 Sequence
    AAAGATTCACCAGGCACCC
  • Primer 2 Sequence
    GTTCATACTTTGCTTGCAGATCC
  • ID
    MGI:700970
  • Product Size
    133
  • Other IDs
    D11Mit243 (BROAD)
  • Note
    MIT assay: MT3138
    Additional information: MIT STS Marker Data Files
Genes
D11Mit243a DNA segment, Chr 11, Massachusetts Institute of Technology 243a
D11Mit243b DNA segment, Chr 11, Massachusetts Institute of Technology 243b
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit243a a 132bp BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac
b 134bp A/J, B6.Cg-Lepob/+, C57BL/6J
c 138bp AKR/J
d 140bp NON/ShiLt
e 144bp DBA/2J
J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;
Endonuclease Gene Allele Fragments Strains
D11Mit243a c upper CBA/Kw
k lower KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory