About   Help   FAQ
D17Mit38 Primer Detail
Primers
  • Name
    D17Mit38
  • Primer 1 Sequence
    CCTCTGAGGAGTAACCAAGCC
  • Primer 2 Sequence
    CACAGAGTTCTACCTCCAACCC
  • ID
    MGI:700962
  • Product Size
    109
  • Other IDs
    D17Mit38 (BROAD)
  • Note
    MIT assay: B115
    Additional information: MIT STS Marker Data Files
Genes
D17Mit38 DNA segment, Chr 17, Massachusetts Institute of Technology 38
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit38 a 110bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 102bp 129X1/SvJ
c 86, 110bp CD-1
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit38 a largest C57BL/6, JF1, MSM/Ms
b smaller DBA/2
J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4
Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit38 c 92bp BALB/cJ
s 110bp 129X1/SvJ, C57BL/6J
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit38 a 80bp SPRET/EiJ
b 86bp A/J, AKR/J
c 92bp BALB/cJ, C3H/HeJ, DBA/2J
d 100bp CAST/EiJ
e 110bp B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Mit38 a 110bp 129/SvW, BN/aW, C57BL/6W, C57BL/10W
b 92bp BALB/cW, C3H/W, CBA/W, DBA/2W
c 86bp A.CA/W, AKR/W
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory