About   Help   FAQ
D15Mit133 Primer Detail
Primers
  • Name
    D15Mit133
  • Primer 1 Sequence
    GTGTGTTTTGTTCTTTGTAGGTGC
  • Primer 2 Sequence
    TTCCCATACATGTGTAAATGTGC
  • ID
    MGI:700960
  • Product Size
    96
  • Other IDs
    D15Mit133 (BROAD)
  • Note
    MIT assay: MT1771
    Additional information: MIT STS Marker Data Files
Genes
D15Mit133 DNA segment, Chr 15, Massachusetts Institute of Technology 133
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit133 a 93bp A/J, AKR/J
b 97bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J
c 103bp BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
d 117bp CAST/EiJ
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D15Mit133 c larger CBA/Kw
e smaller KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory