About   Help   FAQ
D17Mit32 Primer Detail
Primers
  • Name
    D17Mit32
  • Primer 1 Sequence
    TTGGAGCTGAATACACGCAC
  • Primer 2 Sequence
    GATCTGGTGCTTGTTTATTCCC
  • ID
    MGI:700952
  • Product Size
    150
  • Other IDs
    D17Mit32 (BROAD)
  • Note
    MIT assay: D607
    Additional information: MIT STS Marker Data Files
Genes
D17Mit32 DNA segment, Chr 17, Massachusetts Institute of Technology 32
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit32 a 130bp AKR/J, C3H/HeJ, NOD/MrkTac, NON/ShiLt
b 150bp B6.Cg-Lepob/+, C57BL/6J, SPRET/EiJ
c 152bp LP/J
d 156bp CAST/EiJ
e 158bp A/J, BALB/cJ, DBA/2J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Mit32 a 158bp BALB/cW, BN/aW, DBA/2W
b 150bp 129/SvW, C57BL/6W, C57BL/10W
c 130bp A.CA/W, AKR/W, C3H/W, CBA/W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory