D7Mit230 Primer Detail MGI Mouse MGI:700936

D7Mit230 Primer Detail

Name

D7Mit230
Primer 1 Sequence

GGGTTAACTGCTTTTTAAAAGTGC
Primer 2 Sequence

ACTTCTGCATGTTGCCCTCT
ID

MGI:700936
Product Size

105
Other IDs

D7Mit230 (BROAD)
Note

MIT assay: MT468
Additional information: MIT STS Marker Data Files

D7Mit230

DNA segment, Chr 7, Massachusetts Institute of Technology 230

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit230	a	91bp	C3H/HeJ, DBA/2J, NOD/MrkTac
	b	107bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J, NON/ShiLt
	c	117bp	SPRET/EiJ
	d	133bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D7Mit230	a	107bp	A.CA/W, AKR/W, BALB/cW, BN/aW, C57BL/6W, C57BL/10W
	D7Mit230	b	91bp	129/SvW, C3H/W, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24