About   Help   FAQ
D7Mit238 Primer Detail
Primers
  • Name
    D7Mit238
  • Primer 1 Sequence
    GCATCTGCTTTTCTGCCTCT
  • Primer 2 Sequence
    AGGCACCTGACATTGACCTC
  • ID
    MGI:700928
  • Product Size
    150
  • Other IDs
    D7Mit238 (BROAD)
  • Note
    MIT assay: MTAR110
    Additional information: MIT STS Marker Data Files
Genes
D7Mit238 DNA segment, Chr 7, Massachusetts Institute of Technology 238
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit238 a 116bp A/J, BALB/cJ
b 122bp SPRET/EiJ
c 130bp CAST/EiJ
d 132bp C3H/HeJ, LP/J
e 134bp DBA/2J
f 156bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D7Mit238 a 147bp AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, SJL/J
c 111bp A/JOlaHsd, BALB/cJ
d 125bp 129P3/J, C3H/HeJ, DBA/2J, JF1
p 131bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory