About   Help   FAQ
D4Mit211 Primer Detail
Primers
  • Name
    D4Mit211
  • Primer 1 Sequence
    CAGAAAAAAAAAGAAAAGGACAGG
  • Primer 2 Sequence
    GTTTTGTTCATATTATTTAGTCTGGGC
  • ID
    MGI:700922
  • Product Size
    146
  • Other IDs
    D4Mit211 (BROAD)
  • Note
    MIT assay: MT2679
    Additional information: MIT STS Marker Data Files
Genes
D4Mit211 DNA segment, Chr 4, Massachusetts Institute of Technology 211
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit211 a 145bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NON/ShiLt
b 153bp A/J, BALB/cJ, C3H/HeJ, NOD/MrkTac
c 157bp AKR/J
d 161bp CAST/EiJ
e 163bp LP/J
f 173bp SPRET/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D4Mit211 c 138bp 129P3/J, A/JOlaHsd, AKR/OlaHsd, BALB/cJ, PWB, SJL/J
d 132bp C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J, JF1
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory