About   Help   FAQ
D5Mit240 Primer Detail
Primers
  • Name
    D5Mit240
  • Primer 1 Sequence
    ATTAATGTCCATGGTAGAATGTGC
  • Primer 2 Sequence
    ATTTCATTTGCACATACATGCC
  • ID
    MGI:700908
  • Product Size
    150
  • Other IDs
    D5Mit240 (BROAD)
  • Note
    MIT assay: MT3205
    Additional information: MIT STS Marker Data Files
Genes
D5Mit240 DNA segment, Chr 5, Massachusetts Institute of Technology 240
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D5Mit240 a 156bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 170bp 129X1/SvJ
c 156, 162bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit240 a 154bp AKR/J, LP/J, NOD/MrkTac
b 156bp B6.Cg-Lepob/+, C57BL/6J
c 170bp SPRET/EiJ
d 172bp A/J, BALB/cJ, DBA/2J
e 176bp C3H/HeJ, NON/ShiLt
f 178bp CAST/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D5Mit240 c smaller C58/J
f not given FVB/NJ
i not given I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit240 c 134bp CBA/CaOlaHsd
s 125bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory