About   Help   FAQ
D6Mit138 Primer Detail
Primers
  • Name
    D6Mit138
  • Primer 1 Sequence
    GCTCTTATTAATGAAGAAGAAGGAGG
  • Primer 2 Sequence
    CAAAGAAAGCATTTCAAGACTGC
  • ID
    MGI:700902
  • Product Size
    135
  • Other IDs
    D6Mit138 (BROAD)
  • Note
    MIT assay: D1225
    Additional information: MIT STS Marker Data Files
Genes
D6Mit138 DNA segment, Chr 6, Massachusetts Institute of Technology 138
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit138 a 111bp C57BL/6J
b 113bp B6.Cg-Lepob/+
c 125bp BALB/cJ, DBA/2J, NON/ShiLt
d 131bp A/J, AKR/J, LP/J, NOD/MrkTac
e 135bp C3H/HeJ
f 161bp CAST/EiJ
g 165bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D6Mit138 c 128bp CBA/CaOlaHsd
s 132bp SWR/OlaHsd
J:156851 Golas A, MGI Direct Data Submission. 2010;
Endonuclease Gene Allele Fragments Strains
D6Mit138 b upper C57BL/6J
s lower 129/Sv
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory