D6Mit138 Primer Detail MGI Mouse MGI:700902

D6Mit138 Primer Detail

Name

D6Mit138
Primer 1 Sequence

GCTCTTATTAATGAAGAAGAAGGAGG
Primer 2 Sequence

CAAAGAAAGCATTTCAAGACTGC
ID

MGI:700902
Product Size

135
Other IDs

D6Mit138 (BROAD)
Note

MIT assay: D1225
Additional information: MIT STS Marker Data Files

D6Mit138

DNA segment, Chr 6, Massachusetts Institute of Technology 138

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit138	a	111bp	C57BL/6J
	b	113bp	B6.Cg-Lep^ob/+
	c	125bp	BALB/cJ, DBA/2J, NON/ShiLt
	d	131bp	A/J, AKR/J, LP/J, NOD/MrkTac
	e	135bp	C3H/HeJ
	f	161bp	CAST/EiJ
	g	165bp	SPRET/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit138	c	128bp	CBA/CaOlaHsd
	D6Mit138	s	132bp	SWR/OlaHsd

J:156851 Golas A, MGI Direct Data Submission. 2010;

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit138	b	upper	C57BL/6J
	D6Mit138	s	lower	129/Sv

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23