About   Help   FAQ
D6Mit131 Primer Detail
Primers
  • Name
    D6Mit131
  • Primer 1 Sequence
    AAATCCACATTCAATACAGGTGG
  • Primer 2 Sequence
    GACACTCATGGTCAACTTCTGG
  • ID
    MGI:700895
  • Product Size
    139
  • Other IDs
    D6Mit131 (BROAD)
  • Note
    MIT assay: MT41
    Additional information: MIT STS Marker Data Files
Genes
D6Mit131 DNA segment, Chr 6, Massachusetts Institute of Technology 131
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D6Mit131 b larger C57BL/6J
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit131 a 140bp C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac
b 142bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NON/ShiLt
c 156bp A/J
d 160bp SPRET/EiJ
e 166bp CAST/EiJ
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory