About   Help   FAQ
D4Mit310 Primer Detail
Primers
  • Name
    D4Mit310
  • Primer 1 Sequence
    TCTCCACGTGTGTGCCTTAG
  • Primer 2 Sequence
    TGAAAGCACTCTGCAGACTCA
  • ID
    MGI:700888
  • Product Size
    117
  • Other IDs
    D4Mit310 (BROAD)
  • Note
    MIT assay: MTH1948
    Additional information: MIT STS Marker Data Files
Genes
D4Mit310 DNA Segment, Chr 4, Massachusetts Institute of Technology 310
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit310 a 115bp AKR/J, C3H/HeJ
b 117bp B6.Cg-Lepob/+, C57BL/6J
c 121bp CAST/EiJ, DBA/2J
d 125bp SPRET/EiJ
e 127bp A/J, BALB/cJ
f 129bp NOD/MrkTac, NON/ShiLt
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D4Mit310 a 116bp AKR/OlaHsd, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, JF1
c 126bp A/JOlaHsd, BALB/cJ
d 120bp DBA/2J
g 124bp 129P3/J
l 128bp SJL/J
p 132bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory