D5Mit387 Primer Detail MGI Mouse MGI:700860

D5Mit387 Primer Detail

Name

D5Mit387
Primer 1 Sequence

CCCCATGTATCTCTAGATTAACAATG
Primer 2 Sequence

GCACTCGTGTACATAACCAAATAC
ID

MGI:700860
Product Size

173
Note

MIT assay: MTH3135

D5Mit387

DNA Segment, Chr 5 Massachusetts Institute of Technology 387

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit387	a	174bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
	b	178bp	SPRET/EiJ
	c	182bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, NOD/MrkTac
	d	190bp	CAST/EiJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit387	c	upper	CBA/Kw
	D5Mit387	e	lowerq	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23