About   Help   FAQ
D5Mit387 Primer Detail
Primers
  • Name
    D5Mit387
  • Primer 1 Sequence
    CCCCATGTATCTCTAGATTAACAATG
  • Primer 2 Sequence
    GCACTCGTGTACATAACCAAATAC
  • ID
    MGI:700860
  • Product Size
    173
  • Note
    MIT assay: MTH3135
Genes
D5Mit387 DNA Segment, Chr 5 Massachusetts Institute of Technology 387
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit387 a 174bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
b 178bp SPRET/EiJ
c 182bp A/J, AKR/J, BALB/cJ, C3H/HeJ, NOD/MrkTac
d 190bp CAST/EiJ
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D5Mit387 c upper CBA/Kw
e lowerq KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory