D5Mit388 Primer Detail MGI Mouse MGI:700855

D5Mit388 Primer Detail

Name

D5Mit388
Primer 1 Sequence

TTTCAGAGGGTGGGAGGTAA
Primer 2 Sequence

CCTGGACTCATGGAAGCATT
ID

MGI:700855
Product Size

196
Other IDs

D5Mit388 (BROAD)
Note

MIT assay: MTH3017
Additional information: MIT STS Marker Data Files

D5Mit388

DNA Segment, Chr 5 Massachusetts Institute of Technology 388

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit388	a	180bp	A/J, CAST/EiJ, LP/J
	b	184bp	AKR/J, C3H/HeJ, NOD/MrkTac, NON/ShiLt
	c	188bp	BALB/cJ
	d	192bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	196bp	DBA/2J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D5Mit388	a	187bp	AKR/OlaHsd, C3H/HeJ, SJL/J
	b	195bp	C57BL/6JOlaHsd, C57BL/10
	c	191bp	BALB/cJ
	d	199bp	DBA/2J, PWB
	j	203bp	JF1
	w	183bp	129P3/J, A/JOlaHsd

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23