About   Help   FAQ
D5Mit388 Primer Detail
Primers
  • Name
    D5Mit388
  • Primer 1 Sequence
    TTTCAGAGGGTGGGAGGTAA
  • Primer 2 Sequence
    CCTGGACTCATGGAAGCATT
  • ID
    MGI:700855
  • Product Size
    196
  • Other IDs
    D5Mit388 (BROAD)
  • Note
    MIT assay: MTH3017
    Additional information: MIT STS Marker Data Files
Genes
D5Mit388 DNA Segment, Chr 5 Massachusetts Institute of Technology 388
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit388 a 180bp A/J, CAST/EiJ, LP/J
b 184bp AKR/J, C3H/HeJ, NOD/MrkTac, NON/ShiLt
c 188bp BALB/cJ
d 192bp B6.Cg-Lepob/+, C57BL/6J
e 196bp DBA/2J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D5Mit388 a 187bp AKR/OlaHsd, C3H/HeJ, SJL/J
b 195bp C57BL/6JOlaHsd, C57BL/10
c 191bp BALB/cJ
d 199bp DBA/2J, PWB
j 203bp JF1
w 183bp 129P3/J, A/JOlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory