About   Help   FAQ
D3Mit164 Primer Detail
Primers
  • Name
    D3Mit164
  • Primer 1 Sequence
    GCTCCTGGGAAAGGAAGAAT
  • Primer 2 Sequence
    GATACTTGGGGTTGTGCATACA
  • ID
    MGI:700842
  • Product Size
    135
  • Other IDs
    D3Mit164 (BROAD)
  • Note
    MIT assay: MT1571
    Additional information: MIT STS Marker Data Files
Genes
D3Mit164 DNA segment, Chr 3, Massachusetts Institute of Technology 164
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D3Mit164 b larger C57BL/6J
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit164 a 119bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac
b 129bp CAST/EiJ, SPRET/EiJ
c 135bp B6.Cg-Lepob/+, C57BL/6J, LP/J, NON/ShiLt
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory