About   Help   FAQ
D8Mit184 Primer Detail
Primers
  • Name
    D8Mit184
  • Primer 1 Sequence
    GTTTTTCTCAGAAGAATGCAATATACC
  • Primer 2 Sequence
    TGAGAAGAATGAGGAATTTGTCC
  • ID
    MGI:700826
  • Product Size
    147
  • Other IDs
    D8Mit184 (BROAD)
  • Note
    MIT assay: MT2432
    Additional information: MIT STS Marker Data Files
Genes
D8Mit184 DNA segment, Chr 8, Massachusetts Institute of Technology 184
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit184 a 129bp CAST/EiJ
b 132bp LP/J
c 134bp BALB/cJ
d 149bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
e 151bp A/J, C3H/HeJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D8Mit184 b 135bp C57BL/6JOlaHsd
c 123bp 129P3/J, BALB/cJ
d 137bp A/JOlaHsd, AKR/OlaHsd, C3H/HeJ, C57BL/10, DBA/2J, JF1, SJL/J
p 115bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory