D8Mit184 Primer Detail MGI Mouse MGI:700826

D8Mit184 Primer Detail

Name

D8Mit184
Primer 1 Sequence

GTTTTTCTCAGAAGAATGCAATATACC
Primer 2 Sequence

TGAGAAGAATGAGGAATTTGTCC
ID

MGI:700826
Product Size

147
Other IDs

D8Mit184 (BROAD)
Note

MIT assay: MT2432
Additional information: MIT STS Marker Data Files

D8Mit184

DNA segment, Chr 8, Massachusetts Institute of Technology 184

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit184	a	129bp	CAST/EiJ
	b	132bp	LP/J
	c	134bp	BALB/cJ
	d	149bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	e	151bp	A/J, C3H/HeJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D8Mit184	b	135bp	C57BL/6JOlaHsd
	c	123bp	129P3/J, BALB/cJ
	d	137bp	A/JOlaHsd, AKR/OlaHsd, C3H/HeJ, C57BL/10, DBA/2J, JF1, SJL/J
	p	115bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13