D10Mit206 Primer Detail MGI Mouse MGI:700766

D10Mit206 Primer Detail

Name

D10Mit206
Primer 1 Sequence

AAGACCCATTCATATCCCTAGTT
Primer 2 Sequence

TGCTAACCAAGAAAAGAGAGTCG
ID

MGI:700766
Product Size

141
Other IDs

D10Mit206 (BROAD)
Note

MIT assay: MT2844
Additional information: MIT STS Marker Data Files

DNA segment, Chr 10, Massachusetts Institute of Technology 206

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit206	a	134bp	129X1/Sv
Not Specified	D10Mit206	f	130, 134bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit206	a	101bp	DBA/2J
	b	116bp	CAST/EiJ
	c	130bp	AKR/J
	d	134bp	A/J, BALB/cJ, C3H/HeJ, LP/J
	e	136bp	NOD/MrkTac, NON/ShiLt
	f	148bp	B6.Cg-Lep^ob/+, C57BL/6J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23