About   Help   FAQ
DXMit121 Primer Detail
Primers
  • Name
    DXMit121
  • Primer 1 Sequence
    CCTTTAAACATTGTGATTAGTGATGG
  • Primer 2 Sequence
    CCTAATTTTGAACAGTATCAGTTTTCA
  • ID
    MGI:700737
  • Product Size
    146
  • Other IDs
    DXMit121 (BROAD)
  • Note
    MIT assay: MT2915
    Additional information: MIT STS Marker Data Files
Genes
DXMit121 DNA segment, Chr X, Massachusetts Institute of Technology 121
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit121 a 104bp CAST/EiJ
b 110bp SPRET/EiJ
c 132bp BALB/cJ, NOD/MrkTac
d 146bp C3H/HeJ
e 150bp A/J, AKR/J, B6.Cg-Lepob/+, C57BL/6J, LP/J, NON/ShiLt
f 152bp DBA/2J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
DXMit121 c 146bp CBA/CaOlaHsd
s 148bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory