About   Help   FAQ
D7Mit152 Primer Detail
Primers
  • Name
    D7Mit152
  • Primer 1 Sequence
    GCCTAGCACACGCCAAAG
  • Primer 2 Sequence
    CCTTGTGCATGGTTGCTATG
  • ID
    MGI:700717
  • Product Size
    129
  • Other IDs
    D7Mit152 (BROAD)
  • Note
    MIT assay: MT684
    Additional information: MIT STS Marker Data Files
Genes
D7Mit152 DNA segment, Chr 7, Massachusetts Institute of Technology 152
Polymorphisms
J:43450 Haddad R, et al., Cancer Res. 1997 Oct 15;57(20):4615-23
Endonuclease Gene Allele Fragments Strains
Not Specified D7Mit152 a larger 129/Sv
b absent C57BL/10
c smaller C3H
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit152 a 109bp CAST/EiJ
b 123bp A/J, AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt, SPRET/EiJ
c 127bp B6.Cg-Lepob/+, C57BL/6J
d 133bp BALB/cJ, LP/J
References
J:43450 Haddad R, et al., Genomic imprinting and Igf2 influence liver tumorigenesis and loss of heterozygosity in SV40 T antigen transgenic mice. Cancer Res. 1997 Oct 15;57(20):4615-23
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory