About   Help   FAQ
D7Mit159 Primer Detail
Primers
  • Name
    D7Mit159
  • Primer 1 Sequence
    ATAGCAAAACAAAACAAAACTCTGG
  • Primer 2 Sequence
    GTAACTGGCACGCAGAGACA
  • ID
    MGI:700710
  • Product Size
    148
  • Other IDs
    D7Mit159 (BROAD)
  • Note
    MIT assay: MT941
    Additional information: MIT STS Marker Data Files
Genes
D7Mit159 DNA segment, Chr 7, Massachusetts Institute of Technology 159
Polymorphisms
J:40661 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):390-3
Endonuclease Gene Allele Fragments Strains
Not Specified D7Mit159 a 150bp 129S/SvEv, 129T1/Sv-Dnd1Ter, 129X1/Sv, C3HeB/FeJ
b 160bp 129P1/ReJ, 129P2/Ola, 129P3/J, 129P4/RrRkJ, 129X1/SvJ
c 158bp C57BL/6J
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D7Mit159 a 150bp 129X1/Sv, CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit159 a 146bp BALB/cJ, DBA/2J
b 148bp B6.Cg-Lepob/+, C57BL/6J
c 150bp AKR/J, C3H/HeJ, LP/J, NOD/MrkTac
d 162bp SPRET/EiJ
e 168bp CAST/EiJ
f 172bp A/J, NON/ShiLt
References
J:40661 Threadgill DW, et al., Genealogy of the 129 inbred strains: 129/SvJ is a contaminated inbred strain. Mamm Genome. 1997 Jun;8(6):390-3
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory