D12Mit4 Primer Detail MGI Mouse MGI:700703

D12Mit4 Primer Detail

Name

D12Mit4
Primer 1 Sequence

ACATCCCCAGCTCTTGTTTG
Primer 2 Sequence

AAACCAAACCAAAGAAGCTTAGG
ID

MGI:700703
Product Size

201
Other IDs

D12Mit4 (BROAD)
Note

MIT assay: A64
Additional information: MIT STS Marker Data Files

D12Mit4

DNA segment, Chr 12, Massachusetts Institute of Technology 4

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit4	b	smaller	C57BL/6J
	D12Mit4	f	larger	FVB/N

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D12Mit4	a	largest	JF1, MSM/Ms
Not Specified	D12Mit4	b	smaller	C57BL/6, DBA/2

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit4	a	182bp	AKR/J, NON/ShiLt
	b	194bp	BALB/cJ
	c	197bp	NOD/MrkTac
	d	201bp	B6.Cg-Lep^ob/+
	e	202bp	C57BL/6J
	f	204bp	A/J, C3H/HeJ, DBA/2J, LP/J
	g	212bp	SPRET/EiJ
	h	269bp	CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D12Mit4	a	178bp	129P3/J, AKR/OlaHsd, SJL/J
	b	198bp	C57BL/6JOlaHsd
	c	188bp	BALB/cJ
	d	200bp	A/JOlaHsd, C3H/HeJ, C57BL/10, DBA/2J
	j	216bp	JF1
	p	212bp	PWB

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit4	c	larger	CBA/Kw
	D12Mit4	e	smaller	KE

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23