About   Help   FAQ
DXMit81 Primer Detail
Primers
  • Name
    DXMit81
  • Primer 1 Sequence
    GAGGAGCATCAACCTTCTCG
  • Primer 2 Sequence
    GAGGTGGGGAGAAACAGAGG
  • ID
    MGI:700683
  • Product Size
    200
  • Other IDs
    DXMit81 (BROAD)
  • Note
    MIT assay: MT1219
    Additional information: MIT STS Marker Data Files
Genes
DXMit81 DNA segment, Chr X, Massachusetts Institute of Technology 81
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit81 a 181bp SPRET/EiJ
b 191bp AKR/J, BALB/cJ, CAST/EiJ, DBA/2J, LP/J, NOD/MrkTac
c 193bp C3H/HeJ, NON/ShiLt
d 199bp A/J, B6.Cg-Lepob/+, C57BL/6J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
DXMit81 a 199bp AKR/OlaHsd, C3H/HeJ
d 197bp 129P3/J, A/JOlaHsd, BALB/cJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J, SJL/J
j 183bp JF1
p 181bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory