About   Help   FAQ
D11Mit71 Primer Detail
Primers
  • Name
    D11Mit71
  • Primer 1 Sequence
    GCCATACCTGGTAGCGTGTT
  • Primer 2 Sequence
    AATTTTCAGATGTAGCCATAAGCC
  • ID
    MGI:700679
  • Product Size
    211
  • Other IDs
    D11Mit71 (BROAD)
  • Note
    MIT assay: MPC1313
    Additional information: MIT STS Marker Data Files
Genes
D11Mit71 DNA segment, Chr 11, Massachusetts Institute of Technology 71
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit71 m 171bp MOLF/EiJ
s 159bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit71 a 210bp A/J
b 212bp B6.Cg-Lepob/+
c 214bp AKR/J, C57BL/6J, DBA/2J, NON/ShiLt
d 218bp SPRET/EiJ
e 224bp LP/J
f 228bp BALB/cJ
g 238bp C3H/HeJ
h 280bp CAST/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D11Mit71 c smallest C58/J
f not given FVB/NJ
i smaller I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit71 c 122bp CBA/CaOlaHsd
s 120bp SWR/OlaHsd
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit71 a smaller 129P3/J
s larger SJL/J
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory