About   Help   FAQ
D11Mit74 Primer Detail
Primers
  • Name
    D11Mit74
  • Primer 1 Sequence
    AAAACCTGAGTTCGACCCCT
  • Primer 2 Sequence
    ATAAAGCCTCATCTACATGGGC
  • ID
    MGI:700676
  • Product Size
    218
  • Other IDs
    D11Mit74 (BROAD)
  • Note
    MIT assay: MPC1407
    Additional information: MIT STS Marker Data Files
Genes
D11Mit74 DNA segment, Chr 11, Massachusetts Institute of Technology 74
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit74 a 214bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 226bp 129X1/SvJ
c 214, 226, 232bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit74 a 210bp LP/J
b 214bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J
c 216bp C3H/HeJ
d 226bp BALB/cJ
e 230bp AKR/J, NOD/MrkTac
f 232bp A/J, NON/ShiLt
g 238bp CAST/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory