D4Mit58 Primer Detail MGI Mouse MGI:700663

D4Mit58 Primer Detail

Name

D4Mit58
Primer 1 Sequence

TATTTTTTGGGTTTGGAAGGG
Primer 2 Sequence

CCTTGCAGCCACACTCAGT
ID

MGI:700663
Product Size

187
Other IDs

D4Mit58 (BROAD)
Note

MIT assay: B490
Additional information: MIT STS Marker Data Files

D4Mit58

DNA segment, Chr 4, Massachusetts Institute of Technology 58

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit58	a	178bp	AKR/J, BALB/cJ
	b	192bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	202bp	CAST/EiJ
	d	216bp	SPRET/EiJ

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit58	a	larger	129P3/J
	D4Mit58	s	smaller	SJL/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit58	a	192bp	129/SvW, C57BL/6W, CBA/W, DBA/2W
	D4Mit58	b	178bp	A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, C57BL/10W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23