About   Help   FAQ
D4Mit54 Primer Detail
Primers
  • Name
    D4Mit54
  • Primer 1 Sequence
    CTGCCATCCTGTAGTTTCACTG
  • Primer 2 Sequence
    ACCCCCACATATGTCTCCCT
  • ID
    MGI:700659
  • Product Size
    148
  • Other IDs
    D4Mit54 (BROAD)
  • Note
    MIT assay: B463
    Additional information: MIT STS Marker Data Files
Genes
D4Mit54 DNA segment, Chr 4, Massachusetts Institute of Technology 54
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D4Mit54 b not given C57BL/6J
c 174bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit54 a 150bp B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
b 174bp C3H/HeJ
c 176bp CAST/EiJ
d 190bp BALB/cJ, DBA/2J
e 194bp A/J, AKR/J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D4Mit54 l larger LG/J
s smaller SM/J
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D4Mit54 c smaller CBA/Kw
e larger KE
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory