About   Help   FAQ
D3Mit25 Primer Detail
Primers
  • Name
    D3Mit25
  • Primer 1 Sequence
    GTCTGGGTCGTCAGTGGC
  • Primer 2 Sequence
    TGGAGGCTACCATCTCCAAG
  • ID
    MGI:700639
  • Product Size
    130
  • Other IDs
    D3Mit25 (BROAD)
  • Note
    MIT assay: A726
    Additional information: MIT STS Marker Data Files
Genes
D3Mit25 DNA segment, Chr 3, Massachusetts Institute of Technology 25
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit25 a 114bp SPRET/EiJ
b 127bp DBA/2J
c 128bp NON/ShiLt
d 129bp CAST/EiJ
e 132bp A/J, AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac
f 134bp B6.Cg-Lepob/+, C57BL/6J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D3Mit25 c 128bp CBA/CaOlaHsd
s 124bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory