About   Help   FAQ
D3Mit29 Primer Detail
Primers
  • Name
    D3Mit29
  • Primer 1 Sequence
    GATGAGAGATTCTGATGTGGAGG
  • Primer 2 Sequence
    CCAGCCTCAGTATCTCAAAACC
  • ID
    MGI:700629
  • Product Size
    147
  • Note
    MIT assay: D566
Genes
D3Mit29 DNA segment, Chr 3, Massachusetts Institute of Technology 29
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit29 a 144bp NOD/MrkTac
b 146bp NON/ShiLt
c 148bp AKR/J, C3H/HeJ, LP/J
d 150bp A/J, B6.Cg-Lepob/+, C57BL/6J
e 160bp SPRET/EiJ
f 184bp DBA/2J
g 188bp CAST/EiJ
h 200bp BALB/cJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D3Mit29 c not given C58/J
f not given FVB/NJ
i larger I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D3Mit29 c 196bp CBA/CaOlaHsd
s 243bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/14/2024
MGI 6.23
The Jackson Laboratory