D3Mit28 Primer Detail MGI Mouse MGI:700628

D3Mit28 Primer Detail

Name

D3Mit28
Primer 1 Sequence

GATGAGAGATTCTGATGTGGAGG
Primer 2 Sequence

CCAGCCTCAGTATCTCAAAACC
ID

MGI:700628
Product Size

147
Other IDs

D3Mit28 (BROAD)
Note

MIT assay: D627
Additional information: MIT STS Marker Data Files

D3Mit28

DNA segment, Chr 3, Massachusetts Institute of Technology 28

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit28	a	150bp	A/J, AKR/J, C3H/HeJ, C57BL/6J, NON/ShiLt
	b	152bp	B6.Cg-Lep^ob/+
	c	160bp	SPRET/EiJ
	d	182bp	DBA/2J
	e	188bp	CAST/EiJ
	f	202bp	BALB/cJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit28	c	lower	CBA/Kw
	D3Mit28	e	upper	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24