About   Help   FAQ
D3Mit28 Primer Detail
Primers
  • Name
    D3Mit28
  • Primer 1 Sequence
    GATGAGAGATTCTGATGTGGAGG
  • Primer 2 Sequence
    CCAGCCTCAGTATCTCAAAACC
  • ID
    MGI:700628
  • Product Size
    147
  • Other IDs
    D3Mit28 (BROAD)
  • Note
    MIT assay: D627
    Additional information: MIT STS Marker Data Files
Genes
D3Mit28 DNA segment, Chr 3, Massachusetts Institute of Technology 28
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit28 a 150bp A/J, AKR/J, C3H/HeJ, C57BL/6J, NON/ShiLt
b 152bp B6.Cg-Lepob/+
c 160bp SPRET/EiJ
d 182bp DBA/2J
e 188bp CAST/EiJ
f 202bp BALB/cJ
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D3Mit28 c lower CBA/Kw
e upper KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory