D9Mit196 Primer Detail MGI Mouse MGI:700627

D9Mit196 Primer Detail

Name

D9Mit196
Primer 1 Sequence

GCCTTCTGTTCAGAACTTTCTG
Primer 2 Sequence

TCTGTATTTAAGCATGCATGTGC
ID

MGI:700627
Product Size

143
Other IDs

D9Mit196 (BROAD)
Note

MIT assay: MTH258
Additional information: MIT STS Marker Data Files

D9Mit196

DNA segment, Chr 9, Massachusetts Institute of Technology 196

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit196	c	162bp	C3HeB/FeJLe
	D9Mit196	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit196	a	138bp	CAST/EiJ
	b	148bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	154bp	LP/J
	d	156bp	AKR/J, DBA/2J, NOD/MrkTac, SPRET/EiJ
	e	160bp	A/J
	f	162bp	BALB/cJ, C3H/HeJ
	g	164bp	NON/ShiLt

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit196	c	144bp	CBA/CaOlaHsd
	D9Mit196	s	158bp	SWR/OlaHsd

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit196	a	smaller	129P3/J
	D9Mit196	s	larger	SJL/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24