About   Help   FAQ
D9Mit196 Primer Detail
Primers
  • Name
    D9Mit196
  • Primer 1 Sequence
    GCCTTCTGTTCAGAACTTTCTG
  • Primer 2 Sequence
    TCTGTATTTAAGCATGCATGTGC
  • ID
    MGI:700627
  • Product Size
    143
  • Other IDs
    D9Mit196 (BROAD)
  • Note
    MIT assay: MTH258
    Additional information: MIT STS Marker Data Files
Genes
D9Mit196 DNA segment, Chr 9, Massachusetts Institute of Technology 196
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D9Mit196 c 162bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit196 a 138bp CAST/EiJ
b 148bp B6.Cg-Lepob/+, C57BL/6J
c 154bp LP/J
d 156bp AKR/J, DBA/2J, NOD/MrkTac, SPRET/EiJ
e 160bp A/J
f 162bp BALB/cJ, C3H/HeJ
g 164bp NON/ShiLt
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D9Mit196 c 144bp CBA/CaOlaHsd
s 158bp SWR/OlaHsd
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D9Mit196 a smaller 129P3/J
s larger SJL/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory