About   Help   FAQ
D8Mit6 Primer Detail
Primers
  • Name
    D8Mit6
  • Primer 1 Sequence
    CAGGCAGCTTGCTAGGACTT
  • Primer 2 Sequence
    TACTGCCTTTAGCCCAGTGG
  • ID
    MGI:700625
  • Product Size
    166
  • Other IDs
    D8Mit6 (BROAD)
  • Note
    MIT assay: M158
    Additional information: MIT STS Marker Data Files
Genes
D8Mit6 DNA segment, Chr 8, Massachusetts Institute of Technology 6
Polymorphisms
J:47553 Bartsch JW, et al., Genomics. 1998 Apr 1;49(1):129-32
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit6 b 0.17 kb C57BL/6J
s 0.195 kb SEG/1
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit6 m 185bp MOLF/EiJ
s 220bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit6 a 170bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
b 195bp SPRET/EiJ
c 201bp CAST/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D8Mit6 a 156bp A.CA/W, BN/aW
b 150bp 129/SvW, C3H/W, C57BL/6W, C57BL/10W, DBA/2W
c 142bp AKR/W, BALB/cW, CBA/W
References
J:47553 Bartsch JW, et al., The protein kinase N (PKN) gene PRKCL1/Prkcl1 maps to human chromosome 19p12-p13.1 and mouse chromosome 8 with close linkage to the myodystrophy (myd) mutation. Genomics. 1998 Apr 1;49(1):129-32
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/04/2024
MGI 6.13
The Jackson Laboratory