About   Help   FAQ
D19Mit1 Primer Detail
Primers
  • Name
    D19Mit1
  • Primer 1 Sequence
    AATCCTTGTTCACTCTATCAAGGC
  • Primer 2 Sequence
    CATGAAGAGTCCAGTAGAAACCTC
  • ID
    MGI:700608
  • Product Size
    122
  • Other IDs
    D19Mit1 (BROAD)
  • Note
    MIT assay: A17
    Additional information: MIT STS Marker Data Files
Genes
D19Mit1 DNA segment, Chr 19, Massachusetts Institute of Technology 1
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit1 a 121bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 109 129X1/SvJ
c 142 CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D19Mit1 b smaller C57BL/6J
f larger FVB/N
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit1 a largest JF1, MSM/Ms
b smaller DBA/2
c smallest C57BL/6
J:45418 Hansen GM, et al., Mamm Genome. 1998 Jan;9(1):88-90
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit1 l 0.14kb SB/LeJ
s 0.155kb M. spretus
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit1 m 160bp MOLF/EiJ
s 170bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit1 a 121bp B6.Cg-Lepob/+, C57BL/6J
b 136bp CAST/EiJ
c 140bp NON/ShiLt
d 142bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac
e 144bp LP/J
f 160bp SPRET/EiJ
J:51115 Hansen GM, et al., Genomics. 1999 Mar 1;56(2):228-31
Endonuclease Gene Allele Fragments Strains
D19Mit1 b 0.140kb SB/LeJ
s 0.155kb M. spretus
J:61322 Montgomery JC, et al., MGI Direct Data Submission. 2000;
Endonuclease Gene Allele Fragments Strains
D19Mit1 a 140bp AEJ/Gn
s 160bp M. spretus
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D19Mit1 a 142bp 129/SvW, A.CA/W, AKR/W, BALB/cW, C3H/W, CBA/W, DBA/2W
b 121bp BN/aW, C57BL/6W, C57BL/10W
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:45418 Hansen GM, et al., Pten, a candidate tumor suppressor gene, maps to mouse chromosome 19. Mamm Genome. 1998 Jan;9(1):88-90
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:51115 Hansen GM, et al., A mouse chromosome 19 genetic map including the Lvis1 viral insertion site. Genomics. 1999 Mar 1;56(2):228-31
J:61322 Montgomery JC, et al., Chromosomal localization of the mouse G protein-coupled receptor kinase 5 and 6 genes. MGI Direct Data Submission. 2000;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory