D19Mit3 Primer Detail MGI Mouse MGI:700606

D19Mit3 Primer Detail

Name

D19Mit3
Primer 1 Sequence

CTTCCCCTACTGCAGTGCTC
Primer 2 Sequence

TTGCATAGTTGGCCAAAGTG
ID

MGI:700606
Product Size

199
Other IDs

D19Mit3 (BROAD)
Note

MIT assay: M13
Additional information: MIT STS Marker Data Files

D19Mit3

DNA segment, Chr 19, Massachusetts Institute of Technology 3

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit3	m	199bp	MOLF/EiJ
Not Specified	D19Mit3	s	214bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit3	a	200bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
	b	205bp	AKR/J
	c	206bp	SPRET/EiJ
	d	215bp	LP/J
	e	218bp	CAST/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit3	l	smaller	LG/J
	D19Mit3	s	larger	SM/J

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24