D19Mit6 Primer Detail MGI Mouse MGI:700603

D19Mit6 Primer Detail

Name

D19Mit6
Primer 1 Sequence

ATTAGTAAACTGACTCCCATGCG
Primer 2 Sequence

CTCATGAGTCCCCTGGGTTA
ID

MGI:700603
Product Size

111
Note

MIT assay: B182

D19Mit6

DNA segment, Chr 19, Massachusetts Institute of Technology 6

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit6	a	108bp	CAST/EiJ
	b	112bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	116bp	A/J, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	d	122bp	AKR/J, BALB/cJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D19Mit6	b	108bp	C57BL/6JOlaHsd, C57BL/10, JF1, SJL/J
	c	118bp	AKR/OlaHsd, BALB/cJ
	d	112bp	129P3/J, A/JOlaHsd, C3H/HeJ, DBA/2J
	p	116bp	PWB

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit6	c	135bp	CBA/CaOlaHsd
	D19Mit6	s	131bp	SWR/OlaHsd

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/30/2025 MGI 6.24