About   Help   FAQ
D19Mit6 Primer Detail
Primers
  • Name
    D19Mit6
  • Primer 1 Sequence
    ATTAGTAAACTGACTCCCATGCG
  • Primer 2 Sequence
    CTCATGAGTCCCCTGGGTTA
  • ID
    MGI:700603
  • Product Size
    111
  • Note
    MIT assay: B182
Genes
D19Mit6 DNA segment, Chr 19, Massachusetts Institute of Technology 6
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit6 a 108bp CAST/EiJ
b 112bp B6.Cg-Lepob/+, C57BL/6J
c 116bp A/J, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
d 122bp AKR/J, BALB/cJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D19Mit6 b 108bp C57BL/6JOlaHsd, C57BL/10, JF1, SJL/J
c 118bp AKR/OlaHsd, BALB/cJ
d 112bp 129P3/J, A/JOlaHsd, C3H/HeJ, DBA/2J
p 116bp PWB
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D19Mit6 c 135bp CBA/CaOlaHsd
s 131bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory