About   Help   FAQ
D9Mit64 Primer Detail
Primers
  • Name
    D9Mit64
  • Primer 1 Sequence
    TTCACCAAACCTTATCTTACTCCA
  • Primer 2 Sequence
    TGGAAGAAACAGTGTTGGGT
  • ID
    MGI:700586
  • Product Size
    190
  • Other IDs
    D9Mit64 (BROAD)
  • Note
    MIT assay: MPC511
    Additional information: MIT STS Marker Data Files
Genes
D9Mit64 DNA segment, Chr 9, Massachusetts Institute of Technology 64
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit64 a 164bp LP/J
b 168bp CAST/EiJ
c 172bp SPRET/EiJ
d 184bp AKR/J, DBA/2J
e 186bp NOD/MrkTac
f 190bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NON/ShiLt
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D9Mit64 c 185bp CBA/CaOlaHsd
s 178bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory