About   Help   FAQ
D3Mit217 Primer Detail
Primers
  • Name
    D3Mit217
  • Primer 1 Sequence
    TCATTTATGTGGGGATGCCT
  • Primer 2 Sequence
    TTGGTGAGTTCCAGGCAAAT
  • ID
    MGI:700577
  • Product Size
    127
  • Other IDs
    D3Mit217 (BROAD)
  • Note
    MIT assay: MT2121
    Additional information: MIT STS Marker Data Files
Genes
D1Mit1000 DNA segment, Chr 1, Massachusetts Institute of Technology 1000
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit1000 a 125bp A/J, C3H/HeJ, LP/J, NOD/MrkTac
b 127bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
c 135bp CAST/EiJ
d 141bp AKR/J, NON/ShiLt
e 143bp DBA/2J
f 145bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit1000 c 224bp CBA/CaOlaHsd
s 212bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory