About   Help   FAQ
D3Mit215 Primer Detail
Primers
  • Name
    D3Mit215
  • Primer 1 Sequence
    TAAACATCTAGAAGATGCTGCAGG
  • Primer 2 Sequence
    CTGCATGGCCAGGACTAGTT
  • ID
    MGI:700575
  • Product Size
    143
  • Other IDs
    D3Mit215 (BROAD)
  • Note
    MIT assay: D1276
    Additional information: MIT STS Marker Data Files
Genes
D3Mit215 DNA segment, Chr 3, Massachusetts Institute of Technology 215
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit215 a 128bp CAST/EiJ, SPRET/EiJ
b 148bp B6.Cg-Lepob/+, NOD/MrkTac
c 154bp DBA/2J, LP/J
d 156bp AKR/J, C57BL/6J, NON/ShiLt
e 162bp C3H/HeJ
f 164bp A/J, BALB/cJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D3Mit215 c 204bp CBA/CaOlaHsd
s 196bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory