D3Mit19 Primer Detail MGI Mouse MGI:700563

D3Mit19 Primer Detail

Name

D3Mit19
Primer 1 Sequence

CAGCCAGAGAGGAGCTGTCT
Primer 2 Sequence

GAACATTGGGGTGTTTGCTT
ID

MGI:700563
Product Size

159
Note

MIT assay: M141

D3Mit19

DNA segment, Chr 3, Massachusetts Institute of Technology 19

J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D3Mit19	b	0.160kb	B10.BR-H2^k, B10.D2-H2^d, BALB/cByJ, BALB/cJ, C57BL/6
Not Specified	D3Mit19	c	0.176kb	BALB.K-H2^k, BALB/cAnNCr

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D3Mit19	a	160bp	129X1/Sv
Not Specified	D3Mit19	f	160, 166bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit19	b	smaller	C57BL/6J
	D3Mit19	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit19	a	147bp	SPRET/EiJ
	b	158bp	LP/J
	c	160bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	d	176bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, NOD/MrkTac

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit19	l	larger	LG/J
	D3Mit19	s	smaller	SM/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit19	c	111bp	CBA/CaOlaHsd
	D3Mit19	s	104bp	SWR/OlaHsd

J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23