D11Mit145 Primer Detail MGI Mouse MGI:700554

D11Mit145 Primer Detail

Name

D11Mit145
Primer 1 Sequence

GCTAGTACTTGGGCTGGACG
Primer 2 Sequence

GCTCTACTCCTCCCTGCCTT
ID

MGI:700554
Product Size

150
Other IDs

D11Mit145 (BROAD)
Note

MIT assay: MT221
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 145

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit145	a	152bp	129X1/Sv
Not Specified	D11Mit145	f	140bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit145	a	140bp	A/J, AKR/J, BALB/cJ, CAST/EiJ, NOD/MrkTac, NON/ShiLt
	D11Mit145	b	152bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J

J:156851 Golas A, MGI Direct Data Submission. 2010;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit145	b	upper	C57BL/6J
	D11Mit145	s	lower	129/Sv

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24