D13Mit221 Primer Detail MGI Mouse MGI:700526

D13Mit221 Primer Detail

Name

D13Mit221
Primer 1 Sequence

GGACTGGATTGTCTTGTTGTTG
Primer 2 Sequence

ACACCAATCAATCAAATCATTCA
ID

MGI:700526
Product Size

118
Other IDs

D13Mit221 (BROAD)
Note

MIT assay: MTAR4107
Additional information: MIT STS Marker Data Files

DNA segment, Chr 19, Massachusetts Institute of Technology 1001

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit1001	a	112bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	120bp	129X1/SvJ
		c	112, 124bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit1001	c	122bp	C3HeB/FeJLe
	D19Mit1001	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit1001	a	110bp	DBA/2J, SPRET/EiJ
	b	112bp	BALB/cJ, LP/J
	c	114bp	A/J, AKR/J, NON/ShiLt
	d	120bp	CAST/EiJ
	e	122bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J
	f	124bp	NOD/MrkTac

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit1001	c	123bp	CBA/CaOlaHsd
	D19Mit1001	s	122bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24