About   Help   FAQ
D4Mit178 Primer Detail
Primers
  • Name
    D4Mit178
  • Primer 1 Sequence
    GCCCTGAAGGTAAATCAGTAACT
  • Primer 2 Sequence
    GCTCAGGAGGTACATTGCCT
  • ID
    MGI:700519
  • Product Size
    147
  • Other IDs
    D4Mit178 (BROAD)
  • Note
    MIT assay: MT1508
    Additional information: MIT STS Marker Data Files
Genes
D4Mit178 DNA segment, Chr 4, Massachusetts Institute of Technology 178
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D4Mit178 a 170bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv, CD-1
b 166bp 129X1/SvJ
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D4Mit178 c 170bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit178 a 146bp B6.Cg-Lepob/+, C57BL/6J
b 170bp C3H/HeJ, DBA/2J, NOD/MrkTac
c 172bp AKR/J
d 174bp LP/J
e 176bp A/J, BALB/cJ, NON/ShiLt
f 212bp SPRET/EiJ
g 224bp CAST/EiJ
J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9
Endonuclease Gene Allele Fragments Strains
D4Mit178 c 0.22kb CAST/EiJ
w 0.16kb STOCK Whrnwi
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D4Mit178 c smaller C58/J
f not given FVB/NJ
i not given I/LnJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D4Mit178 a 166bp AKR/OlaHsd
b 144bp C57BL/6JOlaHsd, C57BL/10
c 170bp 129P3/J, A/JOlaHsd, BALB/cJ
d 168bp DBA/2J
h 164bp C3H/HeJ
j 176bp JF1
l 180bp SJL/J
p 190bp PWB
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D4Mit178 c 142bp CBA/CaOlaHsd
s 146bp SWR/OlaHsd
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D4Mit178 c smaller CBA/Kw
e larger KE
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory