About   Help   FAQ
D15Mit179 Primer Detail
Primers
  • Name
    D15Mit179
  • Primer 1 Sequence
    TGTGAAAAGTTTGTACCATACAAATC
  • Primer 2 Sequence
    CACTTGTGCCTCTGTATGCG
  • ID
    MGI:700516
  • Product Size
    147
  • Other IDs
    D15Mit179 (BROAD)
  • Note
    MIT assay: MTAR4050
    Additional information: MIT STS Marker Data Files
Genes
D15Mit179 DNA segment, Chr 15, Massachusetts Institute of Technology 179
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit179 a 148bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, LP/J, NON/ShiLt
b 150bp A/J, NOD/MrkTac
c 152bp BALB/cJ, C3H/HeJ, DBA/2J
d 162bp CAST/EiJ
e 166bp SPRET/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D15Mit179 c not given C58/J
f not given FVB/NJ
i larger I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D15Mit179 c 122bp CBA/CaOlaHsd
s 145bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory