About   Help   FAQ
D2Mit200 Primer Detail
Primers
  • Name
    D2Mit200
  • Primer 1 Sequence
    ATGGCCTCTGCTAAATGGTG
  • Primer 2 Sequence
    GCTAGCAGGAGCGTCATAGG
  • ID
    MGI:700515
  • Product Size
    135
  • Other IDs
    D2Mit200 (BROAD)
  • Note
    MIT assay: MT954
    Additional information: MIT STS Marker Data Files
Genes
D2Mit200 DNA segment, Chr 2, Massachusetts Institute of Technology 200
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit200 a 112bp SPRET/EiJ
b 114bp C3H/HeJ, DBA/2J, NON/ShiLt
c 136bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac
d 158bp CAST/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D2Mit200 a 136bp 129/SvW, A.CA/W, AKR/W, BALB/cW, C57BL/6W, C57BL/10W, CBA/W
b 122bp BN/aW, C3H/W, DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory