About   Help   FAQ
D13Mit34 Primer Detail
Primers
  • Name
    D13Mit34
  • Primer 1 Sequence
    AAGGAACGCACAATATTGCC
  • Primer 2 Sequence
    GAAAGATGTTCAGTGTTGCTCG
  • ID
    MGI:700507
  • Product Size
    101
  • Other IDs
    D13Mit34 (BROAD)
  • Note
    MIT assay: A646
    Additional information: MIT STS Marker Data Files
Genes
D13Mit34 DNA segment, Chr 13, Massachusetts Institute of Technology 34
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D13Mit34 m 99bp MOLF/EiJ
s 134bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit34 a 94bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
b 106bp CAST/EiJ
c 132bp SPRET/EiJ
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory