D13Mit39 Primer Detail MGI Mouse MGI:700502

D13Mit39 Primer Detail

Name

D13Mit39
Primer 1 Sequence

AGGGACAGGCACTCTTAGCA
Primer 2 Sequence

CACAAGGCAGACTGGTCAGA
ID

MGI:700502
Product Size

209
Note

MIT assay: B264

D13Mit39

DNA segment, Chr 13, Massachusetts Institute of Technology 39

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit39	a	184bp	129X1/Sv
Not Specified	D13Mit39	f	184, 194, 208bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit39	a	184bp	LP/J, NOD/MrkTac, NON/ShiLt
	b	194bp	BALB/cJ
	c	200bp	A/J
	d	208bp	AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J
	e	216bp	CAST/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24