About   Help   FAQ
D2Mit493 Primer Detail
Primers
  • Name
    D2Mit493
  • Primer 1 Sequence
    GTCTCTACCTGAGTTTCCATCACA
  • Primer 2 Sequence
    TCCCGAGTTGTCCCTCTATG
  • ID
    MGI:700482
  • Product Size
    110
  • Other IDs
    D2Mit493 (BROAD)
  • Note
    MIT assay: MTH2822
    Additional information: MIT STS Marker Data Files
Genes
D2Mit493 DNA Segment, Chr 2 Massachusetts Institute of Technology 493
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit493 a 97bp A/J, DBA/2J, NOD/MrkTac, SPRET/EiJ
b 109bp AKR/J, B6.Cg-Lepob/+, C57BL/6J
c 123bp CAST/EiJ
d 125bp LP/J, NON/ShiLt
e 127bp BALB/cJ, C3H/HeJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D2Mit493 a 111bp AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10
c 127bp 129P3/J, BALB/cJ, SJL/J
d 97bp A/JOlaHsd, DBA/2J, JF1, PWB
h 129bp C3H/HeJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory